View Single Post
Old 01-20-2011, 11:25 AM   #121
Master Po
Registered User
 
Join Date: Aug 2010
Location: USA
Posts: 363
My Ride: E46 no more
Quote:
Originally Posted by rdsesq View Post
Show me the genome!
You wouldn't know one if you stared at it, let alone what to look for.
Anyways, here you go. Have at it bud.

CGAUTTACTRGAATCACRTGACTGTAGCTEGCATCCGACGACTTAGCTGCATCGACTTGA ACTGTAGCTGCATCCGACGARCTTAGCTGCATCGACTTGACTGTDAGCTGCATCCGACGA CTTAGCTGCATCGEACTTGACTGTAGCTGCATCCGAACTTGACTGDTAGCTGCATCCGA
Master Po is offline   Reply With Quote