01-20-2011, 11:48 AM
|
#122
|
|
ouroboros autorotica
Join Date: Apr 2003
Location: Cali...the only state that matters
Posts: 1,451
My Ride: 2002 330i
|
Quote:
Originally Posted by Master Po
You wouldn't know one if you stared at it, let alone what to look for. 
Anyways, here you go. Have at it bud. 
CGAUTTACTRGAATCACRTGACTGTAGCTEGCATCCGACGACTTAGCTGCATCGACTTGA ACTGTAGCTGCATCCGACGARCTTAGCTGCATCGACTTGACTGTDAGCTGCATCCGACGA CTTAGCTGCATCGEACTTGACTGTAGCTGCATCCGAACTTGACTGDTAGCTGCATCCGA |
And again you prove you know nothing. You are off. You have the wrong number of base codes.
Master Po, yet another epic fail that proves you know nothing of what you speak.
p.s.
I actually worked on systems that were used for part of the Human Genome Project (and the first DES challenge also).
__________________
"The existence of life is a highly overrated phenomenon."
-- Dr Manhattan
quis custodiet ipsos custodes
|
|
|