![]() |
![]() |
|
|
||||||
|
Political Talk
You may discuss anything regarding politics in this forum ONLY. If you cannot respect others opinions, your access to this forum will be removed. |
![]() |
|
|
Thread Tools | Search this Thread | Display Modes |
|
|
#121 |
|
Registered User
|
You wouldn't know one if you stared at it, let alone what to look for.
![]() Anyways, here you go. Have at it bud. ![]() CGAUTTACTRGAATCACRTGACTGTAGCTEGCATCCGACGACTTAGCTGCATCGACTTGA ACTGTAGCTGCATCCGACGARCTTAGCTGCATCGACTTGACTGTDAGCTGCATCCGACGA CTTAGCTGCATCGEACTTGACTGTAGCTGCATCCGAACTTGACTGDTAGCTGCATCCGA |
|
|
|
|
|
#122 | |
|
ouroboros autorotica
Join Date: Apr 2003
Location: Cali...the only state that matters
Posts: 1,451
My Ride: 2002 330i
|
Quote:
![]() ![]() ![]() And again you prove you know nothing. You are off. You have the wrong number of base codes. Master Po, yet another epic fail that proves you know nothing of what you speak. p.s. I actually worked on systems that were used for part of the Human Genome Project (and the first DES challenge also).
__________________
"The existence of life is a highly overrated phenomenon."
-- Dr Manhattan quis custodiet ipsos custodes |
|
|
|
|
|
|
#123 | |
|
Registered User
|
Quote:
Sherlock, you missed the message. |
|
|
|
|
|
|
#124 | |
|
ouroboros autorotica
Join Date: Apr 2003
Location: Cali...the only state that matters
Posts: 1,451
My Ride: 2002 330i
|
Quote:
"You are an idiot Watson....oh don't be like that, practically everyone is." - Sherlock Holmes
__________________
"The existence of life is a highly overrated phenomenon."
-- Dr Manhattan quis custodiet ipsos custodes |
|
|
|
|
|
|
#125 | |
|
Registered User
|
Quote:
![]() Any Asian would have found the message. It involves math. ![]() So much cheap talk. That's a two way street amigo. How about you show some scientific evidence that Asians aren't better in math or academics in general? |
|
|
|
|
|
|
#126 | |
|
ouroboros autorotica
Join Date: Apr 2003
Location: Cali...the only state that matters
Posts: 1,451
My Ride: 2002 330i
|
Quote:
__________________
"The existence of life is a highly overrated phenomenon."
-- Dr Manhattan quis custodiet ipsos custodes |
|
|
|
|
|
|
#127 | |
|
Registered User
|
Quote:
My statement is congruent with easily verifiable observations: NBA/NFL/Olympics track and field/etc all blacks; top school admissions heavily dominated by Asians, etc. etc. ad nauseum. How many times we have to go through this? It's up to guys like you to find an explanation for those facts (in genes or elsewhere). Just because you can't doesn't mean reality is wrong. You just haven't found the code, even if it's staring at your face, like in the fragment pseudo-genome above. ![]() You are making an even bigger statement than I am, one that contradicts reality: that all races are the identical (genetically, I suppose). So prove it. The facts are against you. You back up your statement or GTFO and S T F U. Last edited by Master Po; 01-20-2011 at 08:49 PM. |
|
|
|
|
|
|
#128 |
|
I screwed up and can't post
|
If I believed in the concept of "race" as presented here, I would have concluded that Asians are inferior as a whole.
|
|
|
|
|
|
#129 | |
|
Registered User
|
Quote:
Just trying to point out the fact that your argument for racial superiority is flawed, and historically has proven to be dangerous to those seen as "less than superior." But, obviously you're having a hard time comprehending the rhetoric that you're spewing. Hope you have fun, though. And hope your social policies never get implemented.
__________________
-Mike
** Removed ** Ask an Insurance Adjuster Anything Cup of Joe for a Joe! http://www.greenbeanscoffee.com/coj/ buy my car! Last edited by NOVAbimmer; 01-20-2011 at 11:16 PM. |
|
|
|
|
|
|
#130 | |
|
ouroboros autorotica
Join Date: Apr 2003
Location: Cali...the only state that matters
Posts: 1,451
My Ride: 2002 330i
|
Quote:
Put up or shut your pie hole.
__________________
"The existence of life is a highly overrated phenomenon."
-- Dr Manhattan quis custodiet ipsos custodes |
|
|
|
|
|
|
#131 |
|
Banned
|
You guys are nerds. Why do you insist on playing this game with each other. You're even e-thugging with each other. Pathetic
|
|
|
|
|
|
#132 |
|
Banned
|
Great article on this subject in todays Time magazine. Suggest you all read it and then discuss.
|
|
|
|
|
|
#133 |
|
Registered User
|
I wonder what percent of Asians actually believe that they are superior race
__________________
** Having a single animated non-BMW image in your sig it not allowed - Tim330i **
|
|
|
|
|
|
#134 |
|
Banned
|
According to the article children raised in China under "tiger moms" may excel in school but their self esteem is rock bottom. Kids in America not raised under a strict roof may have lower grades but self esteem is sky high. So the answer to your question would be not as high as you think.
|
|
|
|
|
|
#135 | |
|
Registered User
|
Quote:
Superior in what area? And it doesn't matter what they think. I bet there's someone out there that thinks he's the King of Prusia. So what? Look at statistic, hard facts. Then we discuss. Last edited by Master Po; 01-23-2011 at 07:29 AM. |
|
|
|
|
|
|
#136 | |
|
Registered User
|
Quote:
I meant what percent of Asians think that they're superior (genetics --> intellectually --> academic success --> genetics) simply due to being Asian... similar to how the KKK thinks that they're superior simply due to being white.
__________________
** Having a single animated non-BMW image in your sig it not allowed - Tim330i **
Last edited by dniper71; 01-23-2011 at 08:46 AM. |
|
|
|
|
|
|
#137 |
|
Registered User
|
The hole with this arguement is that when it comes to immigration, usually the best of the best Asians come here (U.S.) so while the statistics do show that top schools are dominated by Asians, you're taking a small sample size, over-magnifying it and applying it to an entire race. I would say that if there was some type of sound standardized test to measure someone's genetic potential (cultural differences play a big part in this type of arguement so these would have to be eliminated from the study), I think the bell curves would look pretty similar for pretty much all the races.
__________________
** Having a single animated non-BMW image in your sig it not allowed - Tim330i **
Last edited by dniper71; 01-23-2011 at 09:04 AM. |
|
|
|
|
|
#138 |
|
ouroboros autorotica
Join Date: Apr 2003
Location: Cali...the only state that matters
Posts: 1,451
My Ride: 2002 330i
|
Most sports are not dominated by blacks and in many cases have fewer blacks than the norm. Soccer, cycling, baseball, tennis, cricket, golf, motor racing (F1, Nascar, Indy, Rally), Swimming. Shall I go on.
And before you come back with the "none of those are real sports" crapola. It is worth pointing out, that the NFL finally equaled the revenue of the English Premier League in 2010. (Yes, that is just revenue from England, that doesn't include every other country in the EU or Mexico or Brazil or ...) That is just the how big soccer (real football) is in the rest of the world. It towers above the NFL. So if your want to attempt a (albeit pathetic) argument about the dominance of black athletes in pro sports, perhaps you should take your blinders off.
__________________
"The existence of life is a highly overrated phenomenon."
-- Dr Manhattan quis custodiet ipsos custodes |
|
|
|
|
|
#139 | |
|
Registered User
|
Quote:
Obviously there are many reasons why they are not. But before we go there, can you explain why the NFL/NBA and track&fields are dominated by blacks? |
|
|
|
|
|
|
#140 |
|
Registered User
|
Master Po, what is your point?
__________________
![]() |
|
|
|
![]() |
| Thread Tools | Search this Thread |
| Display Modes | |
|
|