Why Chinese Mothers Are Superior

Originally Posted by rdsesq

Show me the genome!

You wouldn't know one if you stared at it, let alone what to look for.
Anyways, here you go. Have at it bud.

CGAUTTACTRGAATCACRTGACTGTAGCTEGCATCCGACGACTTAGCTGCATCGACTTGA ACTGTAGCTGCATCCGACGARCTTAGCTGCATCGACTTGACTGTDAGCTGCATCCGACGA CTTAGCTGCATCGEACTTGACTGTAGCTGCATCCGAACTTGACTGDTAGCTGCATCCGA

Originally Posted by Master Po

You wouldn't know one if you stared at it, let alone what to look for.
Anyways, here you go. Have at it bud.

CGAUTTACTRGAATCACRTGACTGTAGCTEGCATCCGACGACTTAGCTGCATCGACTTGA ACTGTAGCTGCATCCGACGARCTTAGCTGCATCGACTTGACTGTDAGCTGCATCCGACGA CTTAGCTGCATCGEACTTGACTGTAGCTGCATCCGAACTTGACTGDTAGCTGCATCCGA

And again you prove you know nothing. You are off. You have the wrong number of base codes.

Master Po, yet another epic fail that proves you know nothing of what you speak.

p.s.
I actually worked on systems that were used for part of the Human Genome Project (and the first DES challenge also).

Originally Posted by rdsesq

And again you prove you know nothing. You are off. You have the wrong number of base codes.

Master Po, yet another epic fail that proves you know nothing of what you speak.

p.s.
I actually worked on systems that were used for part of the Human Genome Project (and the first DES challenge also).

Who cares about your base codes?
Sherlock, you missed the message.

Originally Posted by Master Po

Who cares about your base codes?
Sherlock, you missed the message.

Actually "Watson", I would know one if I saw it. You talk cr@p you can't back up with actual evidence and when you try to you fail. At least you are consistent in being an epic failing poser, I will give you kudos for that.

"You are an idiot Watson....oh don't be like that, practically everyone is."
- Sherlock Holmes

Originally Posted by rdsesq

Actually "Watson", I would know one if I saw it. You talk cr@p you can't back up with actual evidence and when you try to you fail. At least you are consistent in being an epic failing poser, I will give you kudos for that.

"You are an idiot Watson....oh don't be like that, practically everyone is."
- Sherlock Holmes

Got the message yet, Sherlock.
Any Asian would have found the message. It involves math.

So much cheap talk. That's a two way street amigo.
How about you show some scientific evidence that Asians aren't better in math or academics in general?

Originally Posted by Master Po

Got the message yet, Sherlock.
Any Asian would have found the message. It involves math.

So much cheap talk. That's a two way street amigo.
How about you show some scientific evidence that Asians aren't better in math or academics in general?

You made the statement they are. The requirement is on you, not I.

Originally Posted by rdsesq

You made the statement they are. The requirement is on you, not I.

Sounds like a cop out to me.
My statement is congruent with easily verifiable observations: NBA/NFL/Olympics track and field/etc all blacks; top school admissions heavily dominated by Asians, etc. etc. ad nauseum. How many times we have to go through this?
It's up to guys like you to find an explanation for those facts (in genes or elsewhere). Just because you can't doesn't mean reality is wrong. You just haven't found the code, even if it's staring at your face, like in the fragment pseudo-genome above.

You are making an even bigger statement than I am, one that contradicts reality: that all races are the identical (genetically, I suppose). So prove it. The facts are against you. You back up your statement or GTFO and S T F U.

If I believed in the concept of "race" as presented here, I would have concluded that Asians are inferior as a whole.

Originally Posted by Master Po

Fock. I've seen people yank a text out of context to spin it.
But this is the first time I see a spin with the entire context being in the quote.
Good news, we've diagnosed the source of your reading comprehension issue: you stop reading the minute you find what you want to read.
So the NBA and the NFL chose to select all black players strictly because they look prettier all matched up on a TV screen?

I guess a little perspective is in order.
Here here... I can blast Asians as well. This is one area whites (chicks) are superior, I must admit.

how am I spinning your words stating that one race is superior to another. Kind of hard to spin that into anything other than what it is. Spinning it might be trying to paint you as some evil monster, but I'm not.

Just trying to point out the fact that your argument for racial superiority is flawed, and historically has proven to be dangerous to those seen as "less than superior."

But, obviously you're having a hard time comprehending the rhetoric that you're spewing. Hope you have fun, though. And hope your social policies never get implemented.

Originally Posted by Master Po

It's up to guys like you to find an explanation for those facts (in genes or elsewhere). Just because you can't doesn't mean reality is wrong.

Actual hard science on the flaws in Binet and the Flynn effect has already been posted. You choose not to even attempt to rebut it because you cannot.

Put up or shut your pie hole.

You guys are nerds. Why do you insist on playing this game with each other. You're even e-thugging with each other. Pathetic

Great article on this subject in todays Time magazine. Suggest you all read it and then discuss.

I wonder what percent of Asians actually believe that they are superior race

Originally Posted by dniper71

I wonder what percent of Asians actually believe that they are superior race

According to the article children raised in China under "tiger moms" may excel in school but their self esteem is rock bottom. Kids in America not raised under a strict roof may have lower grades but self esteem is sky high. So the answer to your question would be not as high as you think.

Originally Posted by dniper71

I wonder what percent of Asians actually believe that they are superior race

Please don't fall into those bozo's straw man argument.
Superior in what area?
And it doesn't matter what they think. I bet there's someone out there that thinks he's the King of Prusia. So what?
Look at statistic, hard facts. Then we discuss.

Originally Posted by Sponger

. So the answer to your question would be not as high as you think.

I wasn't thinking anything...

Originally Posted by Master Po

Please don't fall into those bozo's straw man argument.
Superior in what area?
And it doesn't matter what they think. I bet there's someone out there that thinks he's the King of Prusia. So what?
Look at statistic, hard facts. Then we discuss.

I meant what percent of Asians think that they're superior (genetics --> intellectually --> academic success --> genetics) simply due to being Asian... similar to how the KKK thinks that they're superior simply due to being white.

Originally Posted by Master Po

top school admissions heavily dominated by Asians

The hole with this arguement is that when it comes to immigration, usually the best of the best Asians come here (U.S.) so while the statistics do show that top schools are dominated by Asians, you're taking a small sample size, over-magnifying it and applying it to an entire race. I would say that if there was some type of sound standardized test to measure someone's genetic potential (cultural differences play a big part in this type of arguement so these would have to be eliminated from the study), I think the bell curves would look pretty similar for pretty much all the races.

Originally Posted by Master Po

NBA/NFL/Olympics track and field/etc all blacks

Most sports are not dominated by blacks and in many cases have fewer blacks than the norm. Soccer, cycling, baseball, tennis, cricket, golf, motor racing (F1, Nascar, Indy, Rally), Swimming. Shall I go on.

And before you come back with the "none of those are real sports" crapola. It is worth pointing out, that the NFL finally equaled the revenue of the English Premier League in 2010. (Yes, that is just revenue from England, that doesn't include every other country in the EU or Mexico or Brazil or ...) That is just the how big soccer (real football) is in the rest of the world. It towers above the NFL. So if your want to attempt a (albeit pathetic) argument about the dominance of black athletes in pro sports, perhaps you should take your blinders off.

Originally Posted by rdsesq

Most sports are not dominated by blacks and in many cases have fewer blacks than the norm. Soccer, cycling, baseball, tennis, cricket, golf, motor racing (F1, Nascar, Indy, Rally), Swimming. Shall I go on.

And before you come back with the "none of those are real sports" crapola. It is worth pointing out, that the NFL finally equaled the revenue of the English Premier League in 2010. (Yes, that is just revenue from England, that doesn't include every other country in the EU or Mexico or Brazil or ...) That is just the how big soccer (real football) is in the rest of the world. It towers above the NFL. So if your want to attempt a (albeit pathetic) argument about the dominance of black athletes in pro sports, perhaps you should take your blinders off.

Read the part that you quoted again. Did I say ALL SPORTS dominated by blacks?
Obviously there are many reasons why they are not. But before we go there, can you explain why the NFL/NBA and track&fields are dominated by blacks?

Master Po, what is your point?