E46 BMW Social Directory E46 FAQ 3-Series Discussion Forums BMW Photo Gallery BMW 3-Series Technical Information E46 Fanatics - The Ultimate BMW Resource BMW Vendors General E46 Forum The Tire Rack's Tire Wheel Forum Forced Induction Forum The Off-Topic The E46 BMW Showroom For Sale, For Trade or Wanting to Buy

Welcome to the E46Fanatics forums. E46Fanatics is the premiere website for BMW 3 series owners around the world with interactive forums, a geographical enthusiast directory, photo galleries, and technical information for BMW enthusiasts.

You are currently viewing our boards as a guest which gives you limited access to view most discussions and access our other features. By joining our free community you will have access to post topics, communicate privately with other members (PM), respond to polls, upload content and access many other special features. Registration is fast, simple and absolutely free so please, join our community today!

If you have any problems with the registration process or your account login, please contact contact us.

Go Back   E46Fanatics > Everything Else > The Off-Topic > Political Talk

Political Talk
You may discuss anything regarding politics in this forum ONLY. If you cannot respect others opinions, your access to this forum will be removed.

Reply
 
Thread Tools Search this Thread Display Modes
Old 01-20-2011, 11:25 AM   #121
Master Po
Registered User
 
Join Date: Aug 2010
Location: USA
Posts: 283
My Ride: E46 no more
Quote:
Originally Posted by rdsesq View Post
Show me the genome!
You wouldn't know one if you stared at it, let alone what to look for.
Anyways, here you go. Have at it bud.

CGAUTTACTRGAATCACRTGACTGTAGCTEGCATCCGACGACTTAGCTGCATCGACTTGA ACTGTAGCTGCATCCGACGARCTTAGCTGCATCGACTTGACTGTDAGCTGCATCCGACGA CTTAGCTGCATCGEACTTGACTGTAGCTGCATCCGAACTTGACTGDTAGCTGCATCCGA
Master Po is offline   Reply With Quote
Old 01-20-2011, 11:48 AM   #122
rdsesq
ouroboros autorotica
 
rdsesq's Avatar
 
Join Date: Apr 2003
Location: Cali...the only state that matters
Posts: 1,451
My Ride: 2002 330i
Quote:
Originally Posted by Master Po View Post
You wouldn't know one if you stared at it, let alone what to look for.
Anyways, here you go. Have at it bud.

CGAUTTACTRGAATCACRTGACTGTAGCTEGCATCCGACGACTTAGCTGCATCGACTTGA ACTGTAGCTGCATCCGACGARCTTAGCTGCATCGACTTGACTGTDAGCTGCATCCGACGA CTTAGCTGCATCGEACTTGACTGTAGCTGCATCCGAACTTGACTGDTAGCTGCATCCGA


And again you prove you know nothing. You are off. You have the wrong number of base codes.

Master Po, yet another epic fail that proves you know nothing of what you speak.

p.s.
I actually worked on systems that were used for part of the Human Genome Project (and the first DES challenge also).
__________________
"The existence of life is a highly overrated phenomenon."
-- Dr Manhattan

quis custodiet ipsos custodes
rdsesq is offline   Reply With Quote
Old 01-20-2011, 11:49 AM   #123
Master Po
Registered User
 
Join Date: Aug 2010
Location: USA
Posts: 283
My Ride: E46 no more
Quote:
Originally Posted by rdsesq View Post


And again you prove you know nothing. You are off. You have the wrong number of base codes.

Master Po, yet another epic fail that proves you know nothing of what you speak.

p.s.
I actually worked on systems that were used for part of the Human Genome Project (and the first DES challenge also).
Who cares about your base codes?
Sherlock, you missed the message.
Master Po is offline   Reply With Quote
Old 01-20-2011, 01:49 PM   #124
rdsesq
ouroboros autorotica
 
rdsesq's Avatar
 
Join Date: Apr 2003
Location: Cali...the only state that matters
Posts: 1,451
My Ride: 2002 330i
Quote:
Originally Posted by Master Po View Post
Who cares about your base codes?
Sherlock, you missed the message.
Actually "Watson", I would know one if I saw it. You talk cr@p you can't back up with actual evidence and when you try to you fail. At least you are consistent in being an epic failing poser, I will give you kudos for that.

"You are an idiot Watson....oh don't be like that, practically everyone is."
- Sherlock Holmes
__________________
"The existence of life is a highly overrated phenomenon."
-- Dr Manhattan

quis custodiet ipsos custodes
rdsesq is offline   Reply With Quote
Old 01-20-2011, 01:58 PM   #125
Master Po
Registered User
 
Join Date: Aug 2010
Location: USA
Posts: 283
My Ride: E46 no more
Quote:
Originally Posted by rdsesq View Post
Actually "Watson", I would know one if I saw it. You talk cr@p you can't back up with actual evidence and when you try to you fail. At least you are consistent in being an epic failing poser, I will give you kudos for that.

"You are an idiot Watson....oh don't be like that, practically everyone is."
- Sherlock Holmes
Got the message yet, Sherlock.
Any Asian would have found the message. It involves math.

So much cheap talk. That's a two way street amigo.
How about you show some scientific evidence that Asians aren't better in math or academics in general?
Master Po is offline   Reply With Quote
Old 01-20-2011, 07:09 PM   #126
rdsesq
ouroboros autorotica
 
rdsesq's Avatar
 
Join Date: Apr 2003
Location: Cali...the only state that matters
Posts: 1,451
My Ride: 2002 330i
Quote:
Originally Posted by Master Po View Post
Got the message yet, Sherlock.
Any Asian would have found the message. It involves math.

So much cheap talk. That's a two way street amigo.
How about you show some scientific evidence that Asians aren't better in math or academics in general?
You made the statement they are. The requirement is on you, not I.
__________________
"The existence of life is a highly overrated phenomenon."
-- Dr Manhattan

quis custodiet ipsos custodes
rdsesq is offline   Reply With Quote
Old 01-20-2011, 08:16 PM   #127
Master Po
Registered User
 
Join Date: Aug 2010
Location: USA
Posts: 283
My Ride: E46 no more
Quote:
Originally Posted by rdsesq View Post
You made the statement they are. The requirement is on you, not I.
Sounds like a cop out to me.
My statement is congruent with easily verifiable observations: NBA/NFL/Olympics track and field/etc all blacks; top school admissions heavily dominated by Asians, etc. etc. ad nauseum. How many times we have to go through this?
It's up to guys like you to find an explanation for those facts (in genes or elsewhere). Just because you can't doesn't mean reality is wrong. You just haven't found the code, even if it's staring at your face, like in the fragment pseudo-genome above.

You are making an even bigger statement than I am, one that contradicts reality: that all races are the identical (genetically, I suppose). So prove it. The facts are against you. You back up your statement or GTFO and S T F U.


Last edited by Master Po; 01-20-2011 at 08:49 PM.
Master Po is offline   Reply With Quote
Old 01-20-2011, 08:41 PM   #128
Iceman00
Registered User
 
Join Date: Jul 2008
Location: FLA
Posts: 2,736
My Ride: ghey
If I believed in the concept of "race" as presented here, I would have concluded that Asians are inferior as a whole.
Iceman00 is offline   Reply With Quote
Old 01-20-2011, 11:15 PM   #129
NOVAbimmer
Registered User
 
Join Date: Aug 2006
Location: VA
Posts: 10,649
My Ride: GT/CS, 01 330 6MT
Quote:
Originally Posted by Master Po View Post
Fock. I've seen people yank a text out of context to spin it.
But this is the first time I see a spin with the entire context being in the quote.
Good news, we've diagnosed the source of your reading comprehension issue: you stop reading the minute you find what you want to read.
So the NBA and the NFL chose to select all black players strictly because they look prettier all matched up on a TV screen?

I guess a little perspective is in order.
Here here... I can blast Asians as well. This is one area whites (chicks) are superior, I must admit.
how am I spinning your words stating that one race is superior to another. Kind of hard to spin that into anything other than what it is. Spinning it might be trying to paint you as some evil monster, but I'm not.

Just trying to point out the fact that your argument for racial superiority is flawed, and historically has proven to be dangerous to those seen as "less than superior."

But, obviously you're having a hard time comprehending the rhetoric that you're spewing. Hope you have fun, though. And hope your social policies never get implemented.

Last edited by NOVAbimmer; 01-20-2011 at 11:16 PM.
NOVAbimmer is offline   Reply With Quote
Old 01-20-2011, 11:48 PM   #130
rdsesq
ouroboros autorotica
 
rdsesq's Avatar
 
Join Date: Apr 2003
Location: Cali...the only state that matters
Posts: 1,451
My Ride: 2002 330i
Quote:
Originally Posted by Master Po View Post
It's up to guys like you to find an explanation for those facts (in genes or elsewhere). Just because you can't doesn't mean reality is wrong.
Actual hard science on the flaws in Binet and the Flynn effect has already been posted. You choose not to even attempt to rebut it because you cannot.

Put up or shut your pie hole.
__________________
"The existence of life is a highly overrated phenomenon."
-- Dr Manhattan

quis custodiet ipsos custodes
rdsesq is offline   Reply With Quote
Old 01-21-2011, 07:02 AM   #131
b.d.racing
Banned
 
Join Date: Apr 2006
Location: Orlando, FL
Posts: 78
My Ride: 2002 325i
You guys are nerds. Why do you insist on playing this game with each other. You're even e-thugging with each other. Pathetic
b.d.racing is offline   Reply With Quote
Old 01-22-2011, 08:39 PM   #132
Sponger
Banned
 
Sponger's Avatar
 
Join Date: Aug 2003
Location: San Diego, CA
Posts: 267
My Ride: 2000 328ci
Great article on this subject in todays Time magazine. Suggest you all read it and then discuss.
Sponger is offline   Reply With Quote
Old 01-22-2011, 09:41 PM   #133
dniper71
Registered User
 
Join Date: Jul 2005
Location: Earth
Posts: 46
My Ride: A car
I wonder what percent of Asians actually believe that they are superior race
__________________
** Having a single animated non-BMW image in your sig it not allowed - Tim330i **
dniper71 is offline   Reply With Quote
Old 01-22-2011, 10:09 PM   #134
Sponger
Banned
 
Sponger's Avatar
 
Join Date: Aug 2003
Location: San Diego, CA
Posts: 267
My Ride: 2000 328ci
Quote:
Originally Posted by dniper71 View Post
I wonder what percent of Asians actually believe that they are superior race
According to the article children raised in China under "tiger moms" may excel in school but their self esteem is rock bottom. Kids in America not raised under a strict roof may have lower grades but self esteem is sky high. So the answer to your question would be not as high as you think.
Sponger is offline   Reply With Quote
Old 01-23-2011, 07:27 AM   #135
Master Po
Registered User
 
Join Date: Aug 2010
Location: USA
Posts: 283
My Ride: E46 no more
Quote:
Originally Posted by dniper71 View Post
I wonder what percent of Asians actually believe that they are superior race
Please don't fall into those bozo's straw man argument.
Superior in what area?
And it doesn't matter what they think. I bet there's someone out there that thinks he's the King of Prusia. So what?
Look at statistic, hard facts. Then we discuss.

Last edited by Master Po; 01-23-2011 at 07:29 AM.
Master Po is offline   Reply With Quote
Old 01-23-2011, 08:41 AM   #136
dniper71
Registered User
 
Join Date: Jul 2005
Location: Earth
Posts: 46
My Ride: A car
Quote:
Originally Posted by Sponger View Post
. So the answer to your question would be not as high as you think.
I wasn't thinking anything...

Quote:
Originally Posted by Master Po View Post
Please don't fall into those bozo's straw man argument.
Superior in what area?
And it doesn't matter what they think. I bet there's someone out there that thinks he's the King of Prusia. So what?
Look at statistic, hard facts. Then we discuss.
I meant what percent of Asians think that they're superior (genetics --> intellectually --> academic success --> genetics) simply due to being Asian... similar to how the KKK thinks that they're superior simply due to being white.
__________________
** Having a single animated non-BMW image in your sig it not allowed - Tim330i **

Last edited by dniper71; 01-23-2011 at 08:46 AM.
dniper71 is offline   Reply With Quote
Old 01-23-2011, 08:58 AM   #137
dniper71
Registered User
 
Join Date: Jul 2005
Location: Earth
Posts: 46
My Ride: A car
Quote:
Originally Posted by Master Po View Post
top school admissions heavily dominated by Asians
The hole with this arguement is that when it comes to immigration, usually the best of the best Asians come here (U.S.) so while the statistics do show that top schools are dominated by Asians, you're taking a small sample size, over-magnifying it and applying it to an entire race. I would say that if there was some type of sound standardized test to measure someone's genetic potential (cultural differences play a big part in this type of arguement so these would have to be eliminated from the study), I think the bell curves would look pretty similar for pretty much all the races.
__________________
** Having a single animated non-BMW image in your sig it not allowed - Tim330i **

Last edited by dniper71; 01-23-2011 at 09:04 AM.
dniper71 is offline   Reply With Quote
Old 01-23-2011, 01:29 PM   #138
rdsesq
ouroboros autorotica
 
rdsesq's Avatar
 
Join Date: Apr 2003
Location: Cali...the only state that matters
Posts: 1,451
My Ride: 2002 330i
Quote:
Originally Posted by Master Po View Post
NBA/NFL/Olympics track and field/etc all blacks
Most sports are not dominated by blacks and in many cases have fewer blacks than the norm. Soccer, cycling, baseball, tennis, cricket, golf, motor racing (F1, Nascar, Indy, Rally), Swimming. Shall I go on.

And before you come back with the "none of those are real sports" crapola. It is worth pointing out, that the NFL finally equaled the revenue of the English Premier League in 2010. (Yes, that is just revenue from England, that doesn't include every other country in the EU or Mexico or Brazil or ...) That is just the how big soccer (real football) is in the rest of the world. It towers above the NFL. So if your want to attempt a (albeit pathetic) argument about the dominance of black athletes in pro sports, perhaps you should take your blinders off.
__________________
"The existence of life is a highly overrated phenomenon."
-- Dr Manhattan

quis custodiet ipsos custodes
rdsesq is offline   Reply With Quote
Old 01-23-2011, 09:47 PM   #139
Master Po
Registered User
 
Join Date: Aug 2010
Location: USA
Posts: 283
My Ride: E46 no more
Quote:
Originally Posted by rdsesq View Post
Most sports are not dominated by blacks and in many cases have fewer blacks than the norm. Soccer, cycling, baseball, tennis, cricket, golf, motor racing (F1, Nascar, Indy, Rally), Swimming. Shall I go on.

And before you come back with the "none of those are real sports" crapola. It is worth pointing out, that the NFL finally equaled the revenue of the English Premier League in 2010. (Yes, that is just revenue from England, that doesn't include every other country in the EU or Mexico or Brazil or ...) That is just the how big soccer (real football) is in the rest of the world. It towers above the NFL. So if your want to attempt a (albeit pathetic) argument about the dominance of black athletes in pro sports, perhaps you should take your blinders off.
Read the part that you quoted again. Did I say ALL SPORTS dominated by blacks?
Obviously there are many reasons why they are not. But before we go there, can you explain why the NFL/NBA and track&fields are dominated by blacks?
Master Po is offline   Reply With Quote
Old 01-23-2011, 09:54 PM   #140
'busa
Registered User
 
'busa's Avatar
 
Join Date: Jun 2005
Location: FL
Posts: 1,446
My Ride: E90 335i (sold)
Master Po, what is your point?
__________________
'busa is offline   Reply With Quote
Reply

Thread Tools Search this Thread
Search this Thread:

Advanced Search
Display Modes

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off
Censor is ON

Forum Jump




All times are GMT -5. The time now is 03:37 AM.


Powered by vBulletin® Version 3.8.7
Copyright ©2000 - 2013, vBulletin Solutions, Inc.
(c) 1999 - 2011 performanceIX Inc - privacy policy - terms of use